Next Generation Synthesis
Joe Jacobson (MIT) & Emily LeProust (Twist Biosciences)
TA: Eyal Perry
Class Outline: http://fab.cba.mit.edu/classes/S63.21/class_site/pages/class_4.html
Skills covered:
Useful Resources
- Demo videos for essential synbio skills: Synthetic Biology One
Introduction:
Read
We will be changing the color-generating chromophore of the purple Acropora millepora chromoprotein (amilCP) to a variety of orange, pink, and blue mutants. These divergently-colored genetic variants of amilCP were described by Liljeruhm et al in 2018. Their strategy to identify where to mutate amilCP was inferred by sequence similarities to the chromophore region that allows for spectral engineering of the structurally-characterized and well-known green fluorescent protein (GFP), which is native to the jellyfish Aequorea victoria. First, we will prepare for a Gibson assembly by using polymerase chain reaction (PCR) to produce two sets of amplicons as inserts and a restriction digest of the common cloning plasmid pUC19 to produce a new backbone (i.e. origin of replication and drug resistance gene). As a template, both reactions use the amilCP-encoding plasmid that was miniprepped from the Addgene mUAV sample (deposited by the Nakayama lab at the University of Edinburgh and related to their paper on Mobius Assembly via a Mobius Assembly Universal Acceptor Vector). One set of amplicons copy the region of the amilCP gene that precedes the chromophore, including the transcription promoter and translation ribosome-binding site (RBS). Another set of amplicons copy the region that spans 24 basepairs before the chromophore to just beyond the gene's transcription terminators. The latter includes a diversified chromophore-coding segment dictated by mismatches in the PCR primers with respect to the mUAV DNA template. The amplicon sets both include one end that overlaps by 20-22 bases with distinct ends of the large backbone fragment from the pUC19 digest. Lastly, we will express our colorful variety of amilCP mutants in electrocompetent E coli cell.
Homework
Part A: Primer Design and Fragment Assembly
In this part, we will prepare and order the primers that will generate a library of mutated amilCP expressing E. coli cells. We will use Gibson Assembly to insert our mutated gene into a plasmid, which in turn will be transformed into electrocompetent E. coli cells. First, let's understand what is Gibson Assembly and how to design primers for it.
Design primers to amplify two sets of amplicons from mUAV plasmid. The amplicons sets must include one end that overlaps by 20-22 bases with distinct ends of the pUC19 backbone.
Instructions
- Import the pUC19 plasmid sequence from Addgene into Benchling
- Restriction digest pUC19 with PvuII and identify the backbone you want to use for your assembly. [Hint: You need a selection marker and origin of replication!]
- Import the mUAV plasmid sequence into Benchling, by going to Import DNA Sequences > Search External Databases and input the GenBank identifier MG252981.1
- Interestingly, we will be actually be using a Twist Gene Fragment as the source DNA. For our 1kb fragment, both the price and delivery times are better compared to plasmids, and importantly, require less TA lab work (no need to miniprep). To examine which fragment we ordered, use this link: https://benchling.com/s/seq-uivVVxZrv3WxMWNhyTJu
- Identify the amilCP gene, RBS, promoter, and terminators in Plasmid mUAV.
- As described in Liljeruhm et al, the amilCP gene contains a chromophore (CP) region that can be mutated to express different colors. The mutation region is: cagTGTCAGtac
- Identify the CP mutation sequence (TGTCAG) in the gene and annotate it.
- Notice that there's more than one right answer! One amino acid sequence can be coded by multiple DNA sequences.
- We will split create two fragments out of the mUAV plasmid. One fragment will contain the RBS, promoter and first part of amilCP gene right up until the CP mutation region. The second fragment will include the CP mutation all the until the terminators.
- To generate these two fragments, we will design four primers (two forward, two reverse). Each of the primer sequences should follow the primer design guidelines to increase your chances of success in the experiment. A few guidelines as taken from here
- Primer Length: It is generally accepted that the optimal length of PCR primers is 18-22 bp. This length is long enough for adequate specificity and short enough for primers to bind easily to the template at the annealing temperature. However, in our case we will design long overhangs to prepare for Gibson Assembly, so the binding region of the primer should be 18-22 bp, followed by a 20-22 bp overhang.
- Melting Temperature (Tm): the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability. Primers with melting temperatures in the range of 52-58C generally produce the best results. Primers with melting temperatures above 65C have a tendency for secondary annealing. Importantly, primers in the same set should have a similar Tm (5C) between each other!
- GC clamp: The presence of G or C bases within the last five bases from the 3' end of primers (GC clamp) helps promote specific binding at the 3' end due to the stronger bonding of G and C bases. More than 3 G's or C's should be avoided in the last 5 bases at the 3' end of the primer.
- GC content: the number of G's and C's in the primer as a percentage of the total bases should be 40-60%.
- Primer Secondary Structures (a.k.a primer dimer): Presence of the primer secondary structures produced by intermolecular or intramolecular interactions can lead to poor or no yield of the product. They adversely affect primer template annealing and thus the amplification. They greatly reduce the availability of primers to the reaction.
- Benchling allows us to check for secondary structure by selecting part of the sequence > Create Primer > Check Secondary Structure
- Another great online software is NUPack.
- It can be quite hard to design primers with no secondary structures. A rule of thumb is to keep the Gibbs free energy of each structure at above -10kcal. For your task, just report what are the secondary structures did you get for your primer pairs.
- For more info and a video: https://www.addgene.org/protocols/primer-design/
- In your report, elaborate how you chose your primers and according to these design guidelines. Notice that we can't always make every primer perfect, but the more guidelines you follow the higher your chances of success.
Primers
Instructions
- Outer Forward Primer:
- mUAV: identify an 18-22bp region just before the promoter/RBS. Note that you can see your GC content and Tm on the bottom. Right-click and Create Primer (Forward) to examine the design parameters. Copy the sequence to a text editor.
- pUC19: identify the ~20bp region just after the PvuII cut site.
- Combine these sequences to get your Outer Forward Primer
- Make sure your 5 to 3 orientation is right, this is very confusing!
- Outer Reverse Primer:
- mUAV: identify an 18-22bp region just after the terminators. Right-click and Create Primer (Reverse) to examine the design parameters. Copy the sequence to a text editor.
- pUC10: identify the ~20bp region just after the PvuII cut site.
- Combine these sequences to get your Outer Reverse Primer
- Make sure your 5 to 3 orientation is right, this is very confusing!
- Inner Reverse Primer:
- mUAV: identify the chromophore (CP) mutation region
- Select a 18-24bp region just before the CP mutation region. Right-click and Create Primer (Reverse).
- Copy the sequence to a text editor to get your Inner Reverse Primer
- Inner Forward Primer (Mutations):
- mUAV: identify the chromophore (CP) mutation region
- Select a 18-24bp region before and after the CP mutation region, as well the the CP mutation region (total length: 18-24 + 6 + 18-24 = 42-54bp!)
- This will be our PCR primer + overhang for Gibson Assembly.
- Copy this sequence to a text editor. Now, use the table you made above to choose which color variant you wish to express.
- You can have multiple colors together! each E.coli cell will only get one plasmid and express it, but we will have many cells and a variety of colors. You can also order different mixes. Go wild.
- To make a mutation library, you have to options:
- Prepare a bunch of primers, that will be synthesized seperately and you will later mix them together using the robot.
- Use degenerate bases, where a single letter (e.g. H) means it could be a number of different bases (e.g. A/C/T).
- For example, if we synthesize the sequence HTGAA, we will get a mixture of: ATGAA, CTGAA, TGTAA in a single tube.
- Your set of sequences is your Inner Forward Primer
- Outer Forward Primer:
I imported the pUC19 plasmid sequence from Addgene into Benchling and looked up the PvuII restriction digest to look for the backbone to use in the assembly. (Identify selection marker and origin of replication)
Then I I imported the mUAV plasmid sequence into Benchling with the GenBank identifier. I then created an annotation of the amilCP gene, RBS, promoter, and terminators in the mUAV plasmid.
Then through the Liljeruhm et al paper mentioned, I searched for the chromophore (CP) region in the amilCP gene by searching the mutation region cagTGTCAGtac. It is annotated in pink to the left.
I then created a codon table and found the corresponding DNA sequences to the corresponding amino acids. I had to look up a video on how to use a codon table because I was very confused and forgotten how to use one.
amilCP Variants
| Variant | Amino Acids | Sequence |
|---|---|---|
| Original | C Q | TGTCAG |
| Orange | V G | GTCGGT |
| Carnation Pink | V S | GTATCG |
| Pink | A C | GTGTGT |
| Fuchsia | V L | GTTCTA |
| Violet | S M | TCAATG |
| Purple | F M | TTCATG |
| Blue | V N | GTCAAT |
| Royal Blue | C Q | TGCCAA |
| Untitled |
Outer Forward Primer:
Design: 5'tggccgattcattaatgcagggtctctatatgcaggtg3'
mUAV:
Sequence: 5' ggtctctatatgcaggtg 3'
3' Location: 2052
Length: 19 bp
GC: 52.63 %
Melting Temp: 51.2°C
pUC19:
Sequence: 5' tggccgattcattaatgcag 3'
3' Location: 54
Length: 19 bp
GC: 46.37 %
Melting Temp: 51.3°C
Outer Reverse Primer:
Design: 5'gcctcttcgctattacgccgggtctcaatatgcaggtg3'
mUAV:
Sequence: 5' gggtctcaatatgcaggtg 3'
3' Location: 2902
Length: 19bp
GC: 52.63%
Melting Temp: 51.9°C
Inner Reverse Primer:
Design: 5'ctgtggtgataaaatatcccaagc3'
mUAV:
Sequence: 5'ctgtggtgataaaatatcccaagc3'
3' Location: 2270
Length: 24bp
GC: 41.67%
Melting Temp: 53.9°C
Inner Forward Primer:
Original: 5'gggatattttatcaccacagtgtcagtacggaagcataccattcac3'
Carnation Pink: 5'gggatattttatcaccacagGTATCGtacggaagcataccattcac3'
Orange: 5'gggatattttatcaccacagGTCGGTtacggaagcataccattcac3'
mUAV:
Sequence: 5'gggatattttatcaccacagtgtcagtacggaagcataccattcac3'
3' Location: 2319
Length: 46bp
GC: 43.48%
Melting Temp: 66.4°C
Notes from the AddGene primer design tip video:
Length of the Primer: Optimal range for best yields is 18-24 base pairs. Too short, they can make random DNA out of what you were trying to make, too long and you will have longer processing times.
Annealing & Melting Temps: Annealing allows your primer to basepair with the DNA, melting temp help half of your primers to de-tach from DNA. Annealing temp is 5 degrees lower than the melting temperature. Two primers should have similar melting temperatures. Add 4 degrees for every G or C and 2 degrees for every A or T.
GC Content: Ideal GC content for primers is 40-50%. Include a GC clamp at the 3 prime end of the primer. Include 2-3 Gs or Cs at the end of your primer depending on the sequence. GCs are stronger because they have an extra hydrogen bond compared to As and Ts.
Secondary Structure: There is a chance that the primers could base pair or dimerize with itself. So you should use online tools to avoid hairpins, self-dimers, or cross-dimers! Too many repeats in the nucleotide sequence can cause mis-priming and it can fuse to unintended areas.
Part B: Remote Cloning
In this exercise, we are extracting a specific gene (amilCP) from a plasmid and mutating it using PCR. As we talked about in class, Next Generation DNA synthesis is changing the way we think about bio-design. Twist Bioscience, as part of its gracious support to HTGAA, offers us a special budget for ordering gene fragments and clonal genes. These could be extremely handy for your final projects. Essentially, you could choose any gene you fancy and submit it to Twist. When ordering clonal genes, they already take care of the work of inserting it into a vector (plasmid). Meaning, you can just choose a gene and choose an bacterial expression vector and you will get a bacteria expressing your synthetic gene (with no lab work!)
More details can be found here:
Bonus Content
There are other ways to assemble a fragment library into a plasmid. Another common technique, which we will not be using this week (but keep in mind for final projects!) is Golden Gate Assembly.
Golden Gate Assembly
Toehold Switch











