George Church (Harvard)

TA(s): Jessica Weber, Verena Volf

Class Outline: http://fab.cba.mit.edu/classes/S63.21/class_site/pages/class_2.html

Skills covered:

• Links to Editors and Tutorials

  • CRISPR/Cas9:
    • Short tutorial for designing gRNAs: https://blog.addgene.org/how-to-design-your-grna-for-crispr-genome-editing
    • Benchling specific tutorial for designing gRNAs: https://help.benchling.com/en/articles/670980-design-guide-rnas-grnas
    • List of Cas editors and their PAM sites: https://www.synthego.com/guide/how-to-use-crispr/pam-sequence

  • Base Editors:
    • Base editors contain a nicking or dead Cas9 enzyme fused to a deaminase.
    • a.) PAM requirement: Base editors contain a nicking or dead Cas9 enzyme fused to a deaminase. For designing your guide RNA for base editing you will therefore have a PAM requirement like you would have for any Cas9 experiment.
    • b.) Deamination window: An additional design constraint is that the sequence window in which deamination occurs is only a few base pairs long. You can find information on the deamination windows in the review below (even though some new editors are not included).
    • BE4 and ABE7.10 are good starting points and both use SpCas9 with NGG Pam requirement. Base editors with other PAM sites have been constructed too.
    • Review of base editors (2018) including a list of all base editors, their editing window and PAM requirement: https://www.nature.com/articles/s41576-018-0059-1?WT.feed_name=subjects_animal-biotechnology

  • Other Editors:
    • Prime editor: https://www.nature.com/articles/s41586-019-1711-4
      • Tutorials/tools:
        • https://primeedit.nygenome.org/
        • https://www.nature.com/articles/s41551-020-00622-8

        http://pegfinder.sidichenlab.org/

  • TALEN:
    • For TALENs, you can assume no sequence restrictions -- One of the technology’s previous restrictions was a T starting base, but this has since been overcome. In contrast to the CRISPR/Cas technologies above, your DNA sequence is recognized through interactions between the DNA and the TALEN: each TAL in the array recognizes one base. Note: In order to introduce a double strand break, you will need to design to TALENs targeting the opposing strands.
      • Short guide: https://www.addgene.org/talen/guide/
      • One of the available design resources:

      https://tale-nt.cac.cornell.edu/node/add/talen

      • Directed evolution for overcoming starting base restriction:https://academic.oup.com/nar/article/41/21/9779/1276340

  Optional Reading:

  • Review of genome editors (zinc finger nucleases, TALENs, CRISPR) at the time CRISPR was emerging as editing technology: https://www.cell.com/trends/biotechnology/pdf/S0167-7799(13)00087-5.pdf

  • Clinical trials of genome-editing therapies: https://www.nature.com/articles/d41573-020-00096-y

Homework

Part 1: Overview and Rationale

In a short paragraph, describe the type of mutation you want to introduce and the rationale behind it. For inspiration you can take a look at Prof. Church’s list of potential human genome modifications, browse in one of the functional data bases, or look through published experiments.

Gene: PRNP Genome: GRCh38 (hg38, Homo sapiens) Initially I was going to pick a plant as I am really interested in food systems, but I had difficulties making a decision. Being overwhelmed by all of the choices, I decided to look at the list provided to us from the Church lab. I then saw PRNP and decided to go with that one because I remember reading about prions as a kid and then scaring myself about protein misfolding. PRNP is a gene (on chromosome 20) in humans which codes for PrP (protease-resistant protein). When there is a mutation in the PRNP gene, diseases can be inherited and can also be spread through external cases. *Also made sure that the PAM is NGG.

Part 2: Genomic Sequence

Include the genomic sequence you want to modify in your write up. You don’t need to paste the full sequence; just include the part relevant for designing your editing experiment!

Genomic Sequence (from exon 1): CCCCTTTCCACTCCCGGCTCCCCCGCGTTGTCGGATCAGCAGACCGATTCTGGGCGCTGCGTCGCATCGGTGGCAG

Part 3: Genome Editor Design

Describe which genome editing tool you want to use and submit your design. For CRISPR/Cas9-based editors this means that you will include a sequence of your guide RNA and the name of the Cas9 protein you want to use. SpCas9 is most commonly used and recognizes an 5’-NGG-3’ PAM site (where ‘N’ can be any base), but you might want to use another protein with different PAM sequence for your experiment.

Position: 131909956 had an On-Target Score of 75.6 and an Off Target Score of 97.8. My gRNA (guide RNA) sequence: GGUCUGCUGAUCCGACAACG PAM: CGG